View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5813_high_34 (Length: 251)
Name: NF5813_high_34
Description: NF5813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5813_high_34 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 8 - 107
Target Start/End: Complemental strand, 1602093 - 1601994
Alignment:
| Q |
8 |
caagaaaatcagctcaattatttccatctcacggagtatggacaatgcggacatttcaatcttgatgagggccggtccaataaaattggaggctcggctc |
107 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1602093 |
caagaaaatcagctcaactatttccatctcacggagtatggacaatgcggacatttcaatcttgatgagggccggtccaataaaattggaggctcggctc |
1601994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 218 - 251
Target Start/End: Complemental strand, 1601883 - 1601850
Alignment:
| Q |
218 |
atagatgtgtgggtttggcctaacttgtccattt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
1601883 |
atagatgtgtgggtttggcctaacttgttcattt |
1601850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 218 - 251
Target Start/End: Complemental strand, 6061959 - 6061926
Alignment:
| Q |
218 |
atagatgtgtgggtttggcctaacttgtccattt |
251 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
6061959 |
atagatgtgtgggtttgacctaacttgtccattt |
6061926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 218 - 251
Target Start/End: Original strand, 53220551 - 53220584
Alignment:
| Q |
218 |
atagatgtgtgggtttggcctaacttgtccattt |
251 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
53220551 |
atagatgtgtgggtttgacctaacttgtccattt |
53220584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 75 - 107
Target Start/End: Complemental strand, 14779447 - 14779415
Alignment:
| Q |
75 |
agggccggtccaataaaattggaggctcggctc |
107 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
14779447 |
agggccgttccaataaaattggaggctcggctc |
14779415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 218 - 251
Target Start/End: Complemental strand, 27082549 - 27082516
Alignment:
| Q |
218 |
atagatgtgtgggtttggcctaacttgtccattt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
27082549 |
atagatgtgtgggtttggcctaacttgttcattt |
27082516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University