View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5813_low_19 (Length: 356)
Name: NF5813_low_19
Description: NF5813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5813_low_19 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 16 - 356
Target Start/End: Complemental strand, 43452427 - 43452087
Alignment:
| Q |
16 |
ccaagtgctttttcagagaacaaagtcttgacaaccgaagatgcaattatctcatcactgcttccaataatctgtcccagtagaagaactgcagctgttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43452427 |
ccaagtgctttttcagagaacaaagtcttgacaatcgaagatgcaattatctcatcactgcttccaataatctgtccaagtagaagaactgcagctgttt |
43452328 |
T |
|
| Q |
116 |
tgggatttaaacacatgttaaccaagtcttcctctttcttattgaaaacggctatgagggactctactacggccatctcagtaagagtcacagtggatgg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43452327 |
tgggatttaaacacatgttaaccaagtcttcctctttcttattgaaaacggctatgagggactctactacggccatctcagtaagagtcacagtggatgg |
43452228 |
T |
|
| Q |
216 |
gtttaggacatacagtagcacaacagcttctgtcaaccctttcttgaaaagagccattatacattcaacgtcggtatccacgcgtgttagagtctgaata |
315 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43452227 |
gtttaggacatacaatagcacaacagcttctgtcaaccctttcttgaaaagagccattatacattcaacgtcggtatccacgcgtgttagagtctgaata |
43452128 |
T |
|
| Q |
316 |
acagaattgtctctagatcccatctcagccagaaggaaaac |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43452127 |
acagaattgtctctagatcccatctcagccagaaggaaaac |
43452087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University