View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5813_low_20 (Length: 351)
Name: NF5813_low_20
Description: NF5813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5813_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 9 - 253
Target Start/End: Original strand, 9638287 - 9638536
Alignment:
| Q |
9 |
gataatacttgtgaacataattattgtttatctataattgctatgtttaaaaatacctcataagcacactgt-ggcggcgaaacaaagcgtatccaaata |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9638287 |
gataacacttgtgaacataattattgtttatctataattgctatgtttaaaaatacctcataagcacactgttggcggcgaaacaaagcgtatccaaata |
9638386 |
T |
|
| Q |
108 |
tctggtggaacttagaacgtgtttagttgagtgttgaacaattttcacgtaagtttatataatctccattaaatatggacctctctcttagccatgattt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9638387 |
tctggtggaacttagaacgtgtttagttgagtgttgaacaattttcacgtaagtttatataatctccattaaatatggacctctctcttagccatgattt |
9638486 |
T |
|
| Q |
208 |
----attgattcatcatattgtatgaacgagtttagttcattctactgga |
253 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9638487 |
aaacattgattcatcatattgtatgagcgagtttagttcattctactgga |
9638536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University