View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5813_low_24 (Length: 325)
Name: NF5813_low_24
Description: NF5813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5813_low_24 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 258; Significance: 1e-143; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 20 - 325
Target Start/End: Original strand, 48546341 - 48546642
Alignment:
| Q |
20 |
acataaacagaccaaactactacttctctgtccttaactgatcctaagtaatctgcctnnnnnnnnnnnnntaactgtaaggaaaaataaatgaatggat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
48546341 |
acataaacagaccaaactactacttctctgtccttaactgatcctaagtaatctgcctaaaaaaaaa----taactgcaaggaaaaataaatgaatggat |
48546436 |
T |
|
| Q |
120 |
gaacaatttccctccctctctcagttcaaataattggtctcatgatccataggcaagactttactcaaaatacagttgattctgaagtttagttaagact |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48546437 |
gaacaatttccctccctctctcagttcaaataattggtctcatgatccataggcaagactttactcaaaatacagttgattctgaagtttagttaagact |
48546536 |
T |
|
| Q |
220 |
tccgagcaatcagacaagctcaaccaaaatcataccagtttactgatttgggaagacatctctatatttagcatcctcaattgacaaatgctagctacct |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48546537 |
tccgagcaatcagacaagctcaaccaaaatcataccagtttactgatttgggaagacatctctatatttagcatcctcaattgacaaatgctagctacct |
48546636 |
T |
|
| Q |
320 |
tgcccg |
325 |
Q |
| |
|
|||||| |
|
|
| T |
48546637 |
tgcccg |
48546642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 289 - 325
Target Start/End: Original strand, 48546645 - 48546681
Alignment:
| Q |
289 |
agcatcctcaattgacaaatgctagctaccttgcccg |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48546645 |
agcatcctcaattgacaaatgctagctaccttgcccg |
48546681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University