View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5813_low_32 (Length: 269)
Name: NF5813_low_32
Description: NF5813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5813_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 21 - 253
Target Start/End: Original strand, 1246825 - 1247059
Alignment:
| Q |
21 |
ttctcttttgagtgtttcgtttgtgtacta-cgttctttgctatgttcgtcacaatcttgcatgaccctattcgtattaaacaaatatttagtttttaat |
119 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
1246825 |
ttctcttttgagtgtttcgattgtgtactaacgttctttgctatgtttgtcacaatcttgcatgaccctattcatattaaacaaatatttagattttaat |
1246924 |
T |
 |
| Q |
120 |
aaattttcccgtttnnnnnnnn-cattgataacttatattcaagttttgtttcattcaatatggaaattttaacgataaatattctactttttacatgta |
218 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1246925 |
aaattttcccgtttaaaaaaaaacattgataacttatattcaatttttgtttcattcaatatggaaattttaacgataaatattctactttttacatgta |
1247024 |
T |
 |
| Q |
219 |
ttcctgccttcgaacacaataccatacctcattta |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
1247025 |
ttcctgccttcgaacacaataccatacctcattta |
1247059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University