View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5813_low_38 (Length: 240)
Name: NF5813_low_38
Description: NF5813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5813_low_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 10 - 223
Target Start/End: Complemental strand, 36423742 - 36423527
Alignment:
| Q |
10 |
ttgcttgcaaaccaaatccatactcaccagcatccatgtatgtcttaaaataccatccatcagtaggatccatataaggcacaaaaagttcagaagtgaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36423742 |
ttgcttgcaaaccaaatccatactcaccagcatccatgtatgtcttaaaataccatccatcagtaggatccatataaggcacaaaaagttcagaagtgaa |
36423643 |
T |
|
| Q |
110 |
ccctttgtaaataacatttctcatctctaatgtatctggatctctcactttagcttgagaaataatggttccagctctagggtcgag--tgagatgaaat |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
36423642 |
ccctttgtaaataacatttctcatctctaatgtatctggatctctcactttagcttgagaaataatggttccagctctagggtcgggtttgagatgaaat |
36423543 |
T |
|
| Q |
208 |
tcccaattagcccatt |
223 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
36423542 |
tcccaattagcccatt |
36423527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University