View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5813_low_39 (Length: 238)
Name: NF5813_low_39
Description: NF5813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5813_low_39 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 42697269 - 42697048
Alignment:
| Q |
18 |
cccttgttactagcttgcctaactacacacactaacgctatgtggaacctttcctatatttcatggggacaatgattgaggccccggaaagtttctattg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42697269 |
cccttgttactagcttgcctaactacacac--taacgctatgtggaacctttcctatatttcatggggacgatgattgaggccccggaaagtttctattg |
42697172 |
T |
|
| Q |
118 |
cactcttctgttatattatatttttccaacaaaccccgggctaacaatcaaaccgttgcctagttgtgagagttataga---agaaccacatcgtattta |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42697171 |
cactcttctgttatattatatttttccaacaaaccacgggctaacaatcaaaccgttgcctagttgtgagagttatagaagaagaaccacatcgtattta |
42697072 |
T |
|
| Q |
215 |
gtttctcatgtatgataaaccaca |
238 |
Q |
| |
|
|||||||||||| ||||||||||| |
|
|
| T |
42697071 |
gtttctcatgtaagataaaccaca |
42697048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University