View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5814_high_55 (Length: 308)
Name: NF5814_high_55
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5814_high_55 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 293
Target Start/End: Complemental strand, 36696455 - 36696163
Alignment:
| Q |
1 |
taaatataataatagcacnnnnnnngaagtcaaactttgttagaatttatttgactcttcattctcttcagcttatgatttgtgtgctctcctcaactat |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36696455 |
taaatataataatagcacaaaaaaagaagtcaaactttgttagaatttatttgactcttcattctattcagcttatgatttgtgtgctctcctcaactat |
36696356 |
T |
 |
| Q |
101 |
aaataggatttatggacccaaataccttctaaagctatctgctcttccgcttttcaatagagcagaagcttcaaatatttcccatagtaaatataattaa |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36696355 |
aaataggatgtatggacccaaataccttctaaagctatctgctcttccagttttcaatagagcagaagcttcaaatatttcccataataaatataattaa |
36696256 |
T |
 |
| Q |
201 |
accaaccccatataacaaaattttctaaaacttttagttagggttgtgaaatttttatagaatggtgtctgaaccaaattcaagtgtgatcac |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36696255 |
accaaccccatataacaaaattttctaaaacttttagttagggttgtgaaatttttatagaatggtgtctgaaccaaattcaagtgtgatcac |
36696163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University