View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5814_high_76 (Length: 250)
Name: NF5814_high_76
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5814_high_76 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 16 - 118
Target Start/End: Original strand, 46912195 - 46912297
Alignment:
| Q |
16 |
atgcacacacagattacaaaagtataaaaacagagagttttttaaaatttaaaataggaaactagctaggtgcagaacagaaaattataacacttccaac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46912195 |
atgcacacacagattacaaaagtataaaaacagagagttttttaaaatttaaaataggaaactagctaggtgcagaacagaaaattataacacttccaac |
46912294 |
T |
 |
| Q |
116 |
ttt |
118 |
Q |
| |
|
||| |
|
|
| T |
46912295 |
ttt |
46912297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 165 - 250
Target Start/End: Original strand, 46912344 - 46912429
Alignment:
| Q |
165 |
tgctgcccctacccataaatgaacccttctactactagctaaaaaccgggataaacaaatttctaaaaaattatagcaatgaacat |
250 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46912344 |
tgctgcccctacccataaatgaacccttccactactagctaaaaaccgggataaacaaatttctaaaaaattatagcaatgaacat |
46912429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University