View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5814_high_76 (Length: 250)

Name: NF5814_high_76
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5814_high_76
NF5814_high_76
[»] chr7 (2 HSPs)
chr7 (16-118)||(46912195-46912297)
chr7 (165-250)||(46912344-46912429)


Alignment Details
Target: chr7 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 16 - 118
Target Start/End: Original strand, 46912195 - 46912297
Alignment:
16 atgcacacacagattacaaaagtataaaaacagagagttttttaaaatttaaaataggaaactagctaggtgcagaacagaaaattataacacttccaac 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46912195 atgcacacacagattacaaaagtataaaaacagagagttttttaaaatttaaaataggaaactagctaggtgcagaacagaaaattataacacttccaac 46912294  T
116 ttt 118  Q
    |||    
46912295 ttt 46912297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 165 - 250
Target Start/End: Original strand, 46912344 - 46912429
Alignment:
165 tgctgcccctacccataaatgaacccttctactactagctaaaaaccgggataaacaaatttctaaaaaattatagcaatgaacat 250  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46912344 tgctgcccctacccataaatgaacccttccactactagctaaaaaccgggataaacaaatttctaaaaaattatagcaatgaacat 46912429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University