View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5814_high_77 (Length: 250)
Name: NF5814_high_77
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5814_high_77 |
 |  |
|
| [»] scaffold0300 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0300 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: scaffold0300
Description:
Target: scaffold0300; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 5003 - 5244
Alignment:
| Q |
1 |
aagtgaattatcattattatttacttttaggctaaagtccagataaatcaatggtttaataattaaatttatggtttattatttttaatatgnnnnnnnt |
100 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
5003 |
aagttaattatcatttttatttacttttaggctaaagtccagagaaatcaatggtttaataattaaatttatggtttattatttttaatatgaaaaaaat |
5102 |
T |
 |
| Q |
101 |
ggtacattttttaataaaatatcattattacttttaaaattgtctcatctgaaatttgctttacacttcaaaatacgtt--aggcaagatgttatattaa |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5103 |
ggtacattttttaataaaatatcattattacttttaaaattgtctcatctgaaatttgctttacacttcaaaatacgttagaggcaagatgttatattaa |
5202 |
T |
 |
| Q |
199 |
agttttggttcaattccttcgttagcactcttttaacctatg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5203 |
agttttggttcaattccttcgttagcactcttttaacctatg |
5244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University