View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5814_high_84 (Length: 246)
Name: NF5814_high_84
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5814_high_84 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 17 - 227
Target Start/End: Original strand, 166212 - 166429
Alignment:
| Q |
17 |
aaatgaatgatatttaagtttcaaaaagtagatttctacttcgtggatgttgt-------aagtattttgttaggaagaagagtaaactatgatactaaa |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
166212 |
aaatgaatgatatttaagtttcaaaaagtagatttctacttcgtggatgttgtaacttgtaagtattttgttaggaagaagagtaaactatgatactaaa |
166311 |
T |
 |
| Q |
110 |
cattgatgactatattatttattaatcttaactggtggaggctgtgagtcagtagggtcctaatggaaagaccagacccttcttctgtagtgacagcaaa |
209 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
166312 |
cattgatgactatactatttattaatcttaactggtggaggctgtgagtcagtagggtcctaatggaaagaccagacccttcttctgtagtgacagcaaa |
166411 |
T |
 |
| Q |
210 |
tttttaatccatatgaat |
227 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
166412 |
tttttaatccatatgaat |
166429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University