View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5814_high_88 (Length: 243)
Name: NF5814_high_88
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5814_high_88 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 19 - 224
Target Start/End: Complemental strand, 37469722 - 37469516
Alignment:
| Q |
19 |
atttgcagggatgagatgatgagcgaagcctcacgccattggagagattcattctggaggatgaaggaagcctcacatcgtagacgagattcattctgga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |||| |||||||||||||||| |
|
|
| T |
37469722 |
atttgcagggatgagatgatgagcgaagcctcgcgccattggagagattcattctggaggatgaaggaagcctcatactgtaggcgagattcattctgga |
37469623 |
T |
 |
| Q |
119 |
ggaagcgttgattaacataaccttgaatttaattccaaaaccctaatctgaacaacaaa-ggacgagtttgccttgccttctttgagcctgtttgttttc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37469622 |
ggaagcgttgattaacataaccttgaatttaattccaaaaccctaatctgaacaacaaagggacgagtttgccttgctttctttgagcctgtttgttttc |
37469523 |
T |
 |
| Q |
218 |
ggtcaat |
224 |
Q |
| |
|
||||||| |
|
|
| T |
37469522 |
ggtcaat |
37469516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 19 - 136
Target Start/End: Original strand, 33004037 - 33004154
Alignment:
| Q |
19 |
atttgcagggatgagatgatgagcgaagcctcacgccattggagagattcattctggaggatgaaggaagcctcacatcgtagacgagattcattctgga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |||||||||||||||| | | | ||||||||||||||| |
|
|
| T |
33004037 |
atttgcagggatgagatgatgagcgaagcctcacgccgttggagaaattcattctggaagatgaaggaagcctcaagccattggagagattcattctgga |
33004136 |
T |
 |
| Q |
119 |
ggaagcgttgattaacat |
136 |
Q |
| |
|
|||||| ||||||||||| |
|
|
| T |
33004137 |
ggaagcattgattaacat |
33004154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 19 - 136
Target Start/End: Original strand, 17594932 - 17595049
Alignment:
| Q |
19 |
atttgcagggatgagatgatgagcgaagcctcacgccattggagagattcattctggaggatgaaggaagcctcacatcgtagacgagattcattctgga |
118 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |||| | || ||||||||| |||| |
|
|
| T |
17594932 |
atttgcagagatgagatgatgagcgaagcctcacgccattggagagactcatactggaggatgaaggaagcgtcacgccatacgagagattcatcttgga |
17595031 |
T |
 |
| Q |
119 |
ggaagcgttgattaacat |
136 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
17595032 |
ggaagcgttgattaacat |
17595049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 78 - 153
Target Start/End: Original strand, 40736070 - 40736145
Alignment:
| Q |
78 |
gatgaaggaagcctcacatcgtagacgagattcattctggaggaagcgttgattaacataaccttgaatttaattc |
153 |
Q |
| |
|
||||||||||||||||| | | | |||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
40736070 |
gatgaaggaagcctcacgccattggagagattcattctggagtaagcgttgattaacataaccttgaattgaattc |
40736145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 34 - 77
Target Start/End: Original strand, 40736068 - 40736111
Alignment:
| Q |
34 |
atgatgagcgaagcctcacgccattggagagattcattctggag |
77 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40736068 |
atgatgaaggaagcctcacgccattggagagattcattctggag |
40736111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University