View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5814_high_94 (Length: 240)
Name: NF5814_high_94
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5814_high_94 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 38487506 - 38487727
Alignment:
| Q |
1 |
tggttaaaaaccgtgtacgattttgaagactttatcaactggatttggttccgtggaagtgtgtttgctaaagctgaagagagctgggaaaagtggtggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38487506 |
tggttaaaaaccgtgtacgattttgaagactttatcaactggatttggttccgtggaagtgtgtttgctaaagctgaagagagctgggaaaagtggtggt |
38487605 |
T |
 |
| Q |
101 |
acgaagagcaagatcatctaaagggaacaggattttggggaaagcttatggagataattttagacctccgtttcttcgtcttccagtacggtattgtcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38487606 |
acgaagagcaagatcatctaaagggaacaggattttggggaaagcttatggagataattttagacctccgtttcttcgtcttccagtacggtattgtcta |
38487705 |
T |
 |
| Q |
201 |
ccagctcgacatagctgcagga |
222 |
Q |
| |
|
|||||||| ||||||||||||| |
|
|
| T |
38487706 |
ccagctcggcatagctgcagga |
38487727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 30121905 - 30122107
Alignment:
| Q |
1 |
tggttaaaaaccgtgtacgattttgaagactttatcaactggatttggttccgtggaagtgtgtttgctaaagctgaagagagctgggaaaagtggtggt |
100 |
Q |
| |
|
||||||||||| || || |||||||| |||||||| ||||||||||||| | |||||||||||||||| ||||||||| |||||||||||| |||||||| |
|
|
| T |
30121905 |
tggttaaaaactgtttatgattttgatgactttatgaactggatttggtacagtggaagtgtgtttgccaaagctgaacagagctgggaaaggtggtggt |
30122004 |
T |
 |
| Q |
101 |
acgaagagcaagatcatctaaagggaacaggattttggggaaagcttatggagataattttagacctccgtttcttcgtcttccagtacggtattgtcta |
200 |
Q |
| |
|
| |||||||| ||||||||||||| ||| || |||||||||||||| |||| ||||| |||||||| || |||||| | |||||||| || ||||| || |
|
|
| T |
30122005 |
atgaagagcaggatcatctaaaggtaaccggcctttggggaaagcttttggaaataatcttagaccttcgcttcttctttttccagtatggaattgttta |
30122104 |
T |
 |
| Q |
201 |
cca |
203 |
Q |
| |
|
||| |
|
|
| T |
30122105 |
cca |
30122107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 113 - 170
Target Start/End: Complemental strand, 22218405 - 22218348
Alignment:
| Q |
113 |
atcatctaaagggaacaggattttggggaaagcttatggagataattttagacctccg |
170 |
Q |
| |
|
|||||||||||| ||| | ||||||||||||||| || |||| |||||||||||||| |
|
|
| T |
22218405 |
atcatctaaaggtaaccaggttttggggaaagcttgtgcagatgattttagacctccg |
22218348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University