View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5814_high_99 (Length: 233)
Name: NF5814_high_99
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5814_high_99 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 16086634 - 16086751
Alignment:
| Q |
1 |
taaaatggatattgctgcagttttgttttaccgcaattttaatcatttacaagatggagtaaccaatttcagtttttgcatattccttgtacttcataga |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
16086634 |
taaagtggatattgctgcagttttgttttaccgaaattttaatcatttacaagatggagtaaccaatttcagtttttggatattccttgtacttcataga |
16086733 |
T |
|
| Q |
101 |
ctgtgatgtaatttctgt |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
16086734 |
ctgtgatgtaatttctgt |
16086751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 134 - 203
Target Start/End: Original strand, 16086895 - 16086964
Alignment:
| Q |
134 |
tttgggctagttcagcatatttgactgtagattcctttatgactttgctcaaaccataattaattgttgg |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
16086895 |
tttgggctagttcagcatatttgactgtagattcctttatgactttgctcaaaccataaataattgttgg |
16086964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 1830028 - 1830118
Alignment:
| Q |
1 |
taaaatggatattgctgcagttttgttttaccgcaattttaatcatttacaagatggagtaaccaatttcagtttttgcatattccttgta |
91 |
Q |
| |
|
|||| |||||||||| ||||||||||||| | |||||||||||||||||||||| || ||||||||||||||||| |||||||||||| |
|
|
| T |
1830028 |
taaagtggatattgcaatagttttgttttactgtaattttaatcatttacaagatgtagcaaccaatttcagtttttttatattccttgta |
1830118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University