View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5814_low_105 (Length: 229)
Name: NF5814_low_105
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5814_low_105 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 80 - 224
Target Start/End: Complemental strand, 2341961 - 2341817
Alignment:
| Q |
80 |
gaaccgacaatcatcatctgaaactcacacatgcaactgcaaggttccgaattcaaatccggatgaatgtgtccaacctagcaaattttgtttctgagag |
179 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2341961 |
gaactgacaatcatcatctaaaactcacacatgcaacttcaaggttccgaattcaaatccggatgaatgtgtccaacctagcaaattttgtttttgagag |
2341862 |
T |
|
| Q |
180 |
tatcttcagtgttagaaaagaggatgagctcataaaaacgtgtga |
224 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2341861 |
tatcttcaatgttagaaaagaggatgagctcataaaaacgtgtga |
2341817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 6 - 61
Target Start/End: Complemental strand, 2342046 - 2341990
Alignment:
| Q |
6 |
aacaatttcatacgataagtctt-tgacatctaaatcaaagggtatggtaacataag |
61 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
2342046 |
aacaatttcatacgataggtcttgtgacatctaaatcaaagggtatgataacataag |
2341990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University