View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5814_low_107 (Length: 226)
Name: NF5814_low_107
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5814_low_107 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 11 - 197
Target Start/End: Complemental strand, 26529419 - 26529232
Alignment:
| Q |
11 |
gcataggcaggtactgaccgcaagagggttagatcaaactcagttgaaaaggtgattgcaatgatggg-aaagattgctaggtgtcaatgtctttttctt |
109 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
26529419 |
gcataggcaggaactgaccgcaagagggttagatcaaactcagttgaaaaggtgattgccatgatggggaaagattgctaggtgtggatgtctttttctt |
26529320 |
T |
 |
| Q |
110 |
gatgcaaattgactaaagactacattaagaagattggagtttgaattctagtgtcaagtaaccagaagattctaatcggcgtgatttt |
197 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
26529319 |
gatgcaaatggactaaagactacgttaagaagattggagtttgaattctagtgtcaagtaactagaagattctaatcggcatgatttt |
26529232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University