View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5814_low_110 (Length: 221)
Name: NF5814_low_110
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5814_low_110 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 19 - 208
Target Start/End: Original strand, 55208422 - 55208608
Alignment:
| Q |
19 |
ttgttttggttttcaatttgttgttgttattattgaattttggatctgaatgaatatgtcaactgatgctcatttccttcaggtgaaccaaaacatgcca |
118 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55208422 |
ttgttttggttttcaatttgt---tgttattattgaattttggatctgaatgaatatgtcaattgatgctcatttccttcaggtgaaccaaaacatgcca |
55208518 |
T |
|
| Q |
119 |
actcttcattctgatcatgtctatgccaacactaagtataacaacaatcaacagagggacgaggttgatcgctttttaatatcacaggtt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
55208519 |
actcttcattctgatcatgtctatgccaacactaagtataacaacaatcaacagagcgacgaggttgatcgctttttaatatcacaggtt |
55208608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University