View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5814_low_113 (Length: 219)
Name: NF5814_low_113
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5814_low_113 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 6615821 - 6615620
Alignment:
| Q |
1 |
atcatcgagtcgatattataagataattgataatattaacaagagtataattaaaaacattaataaatacnnnnnnnnaaatagtattttaattaaagcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6615821 |
atcatcgagtcgatattataagataattgataatactaacaagagtataattaaaaacattaataaata-ttttttttaaatagtattttaattaaagcc |
6615723 |
T |
 |
| Q |
101 |
cgaggaagttccaattttaataggaccataggtgaacattgtgacaacaaaaatggttatgacttatgggtcgtttattgattacgttaggggcggagga |
200 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6615722 |
cgaggaagtaccaattttagtaggaccataggtgaacattgtgacaactaaaatggttatgacttatgggtcgtttattgattacgttaggggcggagga |
6615623 |
T |
 |
| Q |
201 |
aat |
203 |
Q |
| |
|
||| |
|
|
| T |
6615622 |
aat |
6615620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University