View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5814_low_114 (Length: 211)
Name: NF5814_low_114
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5814_low_114 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 17 - 194
Target Start/End: Complemental strand, 26156240 - 26156056
Alignment:
| Q |
17 |
cagagaaaactatagcttagtctagtcagatttttggacttttatgattcgtttataacacggacaaatatttgattccaaaaacgaccttaaaa----- |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26156240 |
cagagaaaactatagcttagtctagtcagatttttggacttttttgattcgtttataacacggacaaatatttgattccaaaaaccaccttaaaagtcca |
26156141 |
T |
|
| Q |
112 |
--gtctcactctcaccaatatcttaagtagttaaggtagtttggttcacctaaatttatgatcctgttcatattatgtatgttaa |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26156140 |
ccgtctcactctcaccaatatcttaagtagttaaggtagtttggttcacctaaatttatgatcctgttcatattatgtatgttaa |
26156056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University