View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5814_low_28 (Length: 438)
Name: NF5814_low_28
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5814_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 2e-84; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 2e-84
Query Start/End: Original strand, 229 - 387
Target Start/End: Complemental strand, 46751404 - 46751246
Alignment:
| Q |
229 |
atttcaaagcttcatgttttcatctgttttgtcaaattggctttgggtttggcattttcaaaatgtgacaaagctttcatctcatgtcactatcttttga |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46751404 |
atttcaaagcttcatgttttcatctgttttgtcaaattggctttgggtttggcattttcaaaatgtgacaaagctttcatctcatgtcactatcttttga |
46751305 |
T |
 |
| Q |
329 |
attaaagatgaacccattattcacaagcaaattgtaaactacgaatgaatgtgcttcgt |
387 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46751304 |
attaaagatgaacccattattcacaagcaaattgtaaactacgaatgaatgtgcttcgt |
46751246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 7 - 117
Target Start/End: Complemental strand, 46751619 - 46751509
Alignment:
| Q |
7 |
tccaagaatatcttcttgcttttgctttaagtctcctacacgaaattaaattgttttacgagaataggatctattagacaaaattatgttttacgagatg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46751619 |
tccaagaatatcttcttgcttttgctttatgtctcctacacgaaattaaattgttttacgagaataggatctattagacaaaattatgttttacgagatg |
46751520 |
T |
 |
| Q |
107 |
gtcaaagatat |
117 |
Q |
| |
|
||||||||||| |
|
|
| T |
46751519 |
gtcaaagatat |
46751509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University