View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5814_low_34 (Length: 420)
Name: NF5814_low_34
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5814_low_34 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 65 - 368
Target Start/End: Complemental strand, 988045 - 987732
Alignment:
| Q |
65 |
gcgtgaattgaagtggcgtgaaacatacatctcatgaatgaattgaaacatctaaaggtaaaggtgtgtggttagagggaatggaggagaggaggaaaat |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
988045 |
gcgtgaattgaagtggcgtgaaacatacatctcatgaatgaattgaaacatctaaggataaaggtgtgtggttagagggaatggaggagaggaggaaaat |
987946 |
T |
|
| Q |
165 |
attttaaatttgactactttttaattcaattatttgaaagatgaaaggtt----------aagaaaatatctctcaaagtcaattttatctctctttcat |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
987945 |
attttaaatttgactactttttaattcaattatttggaagatgaaaggttaagagaatggaagaaaatatctctcaaagtcaattttatctctctttcat |
987846 |
T |
|
| Q |
255 |
tagtgaagaatttagaaccgatagaatatttattgcatgtttaaacttacaaaaatactttggttatatagatttcaacaaactcaacaaattgcatcat |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
987845 |
tagtgaagaatttagaaccgatagaatatttgttgcatgtttagacttacaaaaatactttggttacacagatttcaacaaactcaacaaattgcatcat |
987746 |
T |
|
| Q |
355 |
tttgtaggttgata |
368 |
Q |
| |
|
||||||| |||||| |
|
|
| T |
987745 |
tttgtagattgata |
987732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 988076 - 988024
Alignment:
| Q |
19 |
ggatgaaatgatattgtcctaaatcaattatgcgtgaattgaagtggcgtgaa |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
988076 |
ggatgaaatgatattgtcctaaatcaattatgcgtgaattgaagtggcgtgaa |
988024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University