View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5814_low_44 (Length: 368)
Name: NF5814_low_44
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5814_low_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 194 - 354
Target Start/End: Original strand, 35856187 - 35856347
Alignment:
| Q |
194 |
ggcagttgcttaaccacataaagtctatccgtgacaaggaaatagatgtaggaataattaatccagcagatatattcaagttcggaggcacaaaatatta |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35856187 |
ggcagttgcttaaccacataaagtctatccgtgacaaggaaatagatgtaggaataattaatccagcagatatattcaagttcggaggcacaaaatatta |
35856286 |
T |
 |
| Q |
294 |
cagatatattggttctcttacaagtccaccatgcactgaagatgttatttggacagttttg |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35856287 |
cagatatattggttctcttacaagtccaccatgtactgaagatgttatttggacagttttg |
35856347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 35856029 - 35856122
Alignment:
| Q |
1 |
aaaattctaaagaagagatagctgtgattggaatttggtataaaattggtcgtccagatcccttactttcaaaggttcgctacattttttgtat |
94 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35856029 |
aaaattctaaagacgagatagctgtgattggaatttggtataaaattggtcgtccagatcccttactttcaaaggttcgctacattttttgtat |
35856122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University