View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5814_low_45 (Length: 365)
Name: NF5814_low_45
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5814_low_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 5e-84; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 189 - 346
Target Start/End: Complemental strand, 3840654 - 3840497
Alignment:
| Q |
189 |
aaggttcaagatgcagaatattttgaagaagatgaaggacctgaagccctaggagaagaagtaggaaaaagaggaagcaaacgaggttcagagtctctag |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3840654 |
aaggttcaagatgcagaatattttgaagaagatgaaggacctgaagccctaggagaagaagtaggaaaaagaggaagcaaacgaggttcagagtctctag |
3840555 |
T |
 |
| Q |
289 |
aagttgaagcagctctaggagaaggatgcagaaagaaacccttttctcttatagcttt |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3840554 |
aagttgaagcagctctaggagaaggatgcagaaagaaacccttttctcttatagcttt |
3840497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 3840840 - 3840717
Alignment:
| Q |
1 |
taaacaaaaatagttcaattcgatggtaaaataattcttgatccgactcgacaaaagattattgaattgtcttccataaaataaaacactaatacaaatc |
100 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3840840 |
taaacaaaaatagttcaatttgaaggtaaaataattcttgatccgactcgacaaaagattattgaattgtcttccataaaataaaacactaatacaaatc |
3840741 |
T |
 |
| Q |
101 |
aatccatttcattagcaacaatgg |
124 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
3840740 |
aatccatttcattagcaacaatgg |
3840717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University