View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5814_low_46 (Length: 364)
Name: NF5814_low_46
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5814_low_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 13 - 357
Target Start/End: Complemental strand, 4115294 - 4114962
Alignment:
| Q |
13 |
aatatgtagtcaccttacttatatgatgttcatgttcatttatatctaacatgaaagtcatttactcacacttgacaggtcaacggcaacgacacaccat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
4115294 |
aatatgtagtcaccttacttatatgatgttcatgttcgtttatatctaacatgaaagttatttactcacacttgacacatcaacggcaatgacacaccac |
4115195 |
T |
 |
| Q |
113 |
caactatgttgaatcttaaatctaatcttaaacttaaaatttggtcatatccgattttttatgagtctcaagttgcctgattgcaaggattcctgctaaa |
212 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4115194 |
caactatgttcaatcttaaa------------cttaaaatttggtcatatccgattttttatgagtctcaagttgcctgattgcaaggattcctgctaaa |
4115107 |
T |
 |
| Q |
213 |
attttgctcgatctttgcaattttatccaaaatgtgtaaagcatcattagacgtgtgctctttatacgttatattcactccagttgtcatagtttaattt |
312 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4115106 |
attttgctcgattattgcaattttatccaaaatgtctaaagcatcattagacgtgtgctctctatacgttatattcacttcagttgtcatagtttaattt |
4115007 |
T |
 |
| Q |
313 |
tggtcaatgttggatttcaataatagccaaaattccaacaaattg |
357 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4115006 |
tggtcaatgtatgatttcaataatagccaaaattccaacaaattg |
4114962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University