View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5814_low_68 (Length: 266)
Name: NF5814_low_68
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5814_low_68 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 16 - 249
Target Start/End: Complemental strand, 4078249 - 4078016
Alignment:
| Q |
16 |
atccactatatgcatgatgataataaacttctgaccaaccagttgctagaagcttnnnnnnnggacattgctaaggtaacaagagaaaccaaaagaggta |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4078249 |
atccactatatgcatgatgataataaacttctgaccaaccagttgctagaagcttaaaaaaaggacattgctaaggtaacaagagaaaccaaaagaggta |
4078150 |
T |
 |
| Q |
116 |
aatgcaaatggcaattaaggaacaccaaatactagtgttacacaccaatttgggaatcagaatcacttttcattctcttgtagcatttttaacaactatt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4078149 |
aatgcaaatggcaattaaggaacaccaaatactagtgttacacaccaatttgggaatcagaatcacttttcattctcttgtagcatttttaacaactatt |
4078050 |
T |
 |
| Q |
216 |
ctagttgtcactgccatatatctaacacaagaag |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
4078049 |
ctagttgtcactgccatatatctaacacaagaag |
4078016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University