View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5814_low_74 (Length: 250)
Name: NF5814_low_74
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5814_low_74 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 9 - 180
Target Start/End: Original strand, 39675183 - 39675353
Alignment:
| Q |
9 |
gctagataatactaataagagtaataataactccatcatttaaaacgttagtcgctaagtttgnnnnnnnnnnnnnnnnnttacgttcaacgaattattt |
108 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| ||||||||| |
|
|
| T |
39675183 |
gctatataataataataagagtaataataactccatcatttaaaacgttagtcgctaattttgaaaaataaaataaaaaattacgttcaatgaattattt |
39675282 |
T |
 |
| Q |
109 |
aaaactttgtttctttcaaatttgnnnnnnnnaataacactagttttttaaaacttaattagtctgtgcaca |
180 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39675283 |
aaaactttgtttctttcaaatttgtttttttt-ataacactagttttttaaaacttaattagtctgtgcaca |
39675353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 203 - 231
Target Start/End: Original strand, 39675407 - 39675435
Alignment:
| Q |
203 |
agtcaagtaaaggcttcttgtgatgatgt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39675407 |
agtcaagtaaaggcttcttgtgatgatgt |
39675435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University