View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5814_low_76 (Length: 250)
Name: NF5814_low_76
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5814_low_76 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 67 - 250
Target Start/End: Original strand, 4105048 - 4105230
Alignment:
| Q |
67 |
agggatctagacattcttatcaccctctcttatgatttcctaccttatccgtcaaaccaatcatattcatatatccttaa-nnnnnnnnaatgttaataa |
165 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
4105048 |
agggatctagacattctcatcaccctctct-atgatttcccaccttatccgtcaaaccaatcatattcatatatccttaatttttttttaatattaataa |
4105146 |
T |
|
| Q |
166 |
tacttaataaacatccaatctatctaacccataacctnnnnnnngatattaaatacgtctaatcaatataactccatatcattac |
250 |
Q |
| |
|
||||| |||||||| ||||| | ||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4105147 |
tacttgataaacatttaatctctataacccataacct-aaaaaagatattaaataagtctaatcaatataactccatatcattac |
4105230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 4103173 - 4103209
Alignment:
| Q |
19 |
tattatgctctgaatgcccattaaactctagacattc |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4103173 |
tattatgctctgaatgcccattaaactctagacattc |
4103209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University