View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5814_low_88 (Length: 244)
Name: NF5814_low_88
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5814_low_88 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 9800988 - 9800764
Alignment:
| Q |
1 |
taatattgcgggacaatatggtcgaaattgaatttgtgttgccattgcggagacctcaaattcatttatattgtagtcacagttttggttgtggatcgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9800988 |
taatattgcgggacaatatggtcgaaattgaatttgtgttgccattgcggagacctcaaattcatttatattgtagtcacagttttggttgtggatcgca |
9800889 |
T |
 |
| Q |
101 |
atttaaaaccagacacctctttcggcttattaaacaattgttttttaaaggtcctgtgacttcttaatactatatattgttaagaatgttccttattttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9800888 |
atttaaaaccagacacctctttcggcttattaaacaattgttgtttaaaggtcttgtgagttcttaatactatatattgttaagaatgtttcttattttc |
9800789 |
T |
 |
| Q |
201 |
taaatttagtatttgaacttgctgt |
225 |
Q |
| |
|
|||||||||||||||||||| |||| |
|
|
| T |
9800788 |
taaatttagtatttgaacttcctgt |
9800764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University