View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5814_low_93 (Length: 243)
Name: NF5814_low_93
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5814_low_93 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 54 - 132
Target Start/End: Original strand, 19828724 - 19828802
Alignment:
| Q |
54 |
aagttcattcatttgtttccttcccttcctcaggctgtttcatttccttcctttcctcaccccattcattccctcacaa |
132 |
Q |
| |
|
|||||||||||||| |||||||| |||||||| | |||||| |||||||| |||||||| |||||||| | ||||||| |
|
|
| T |
19828724 |
aagttcattcatttctttccttctcttcctcacgttgtttcgtttccttctcttcctcacaccattcatccactcacaa |
19828802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 195 - 228
Target Start/End: Complemental strand, 19829092 - 19829059
Alignment:
| Q |
195 |
cttcaaattatcactgtaattactctaatcactg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
19829092 |
cttcaaattatcactgtaattactctaatcactg |
19829059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 196 - 225
Target Start/End: Original strand, 50232338 - 50232367
Alignment:
| Q |
196 |
ttcaaattatcactgtaattactctaatca |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
50232338 |
ttcaaattatcactgtaattactctaatca |
50232367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University