View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5814_low_94 (Length: 243)
Name: NF5814_low_94
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5814_low_94 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 51 - 236
Target Start/End: Original strand, 31641691 - 31641876
Alignment:
| Q |
51 |
ttggtgtgaaaatttggagattcaggcttgatgttgtggtggagagtattattaaggttgctagggttagggttttgttgaggtgggtcccaggtgatgt |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31641691 |
ttggtgtgaaaatttggagattcaggcttgatgttgtggtggagagtattattaaggttgctagggttagggttttgttgaggtgggtcccaggtgatgt |
31641790 |
T |
 |
| Q |
151 |
ggctttgtgggttttggaaactttgttgttgatttgggaagaggaaaagagattggactaatgggtttgtgtttgtggtgatgatg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31641791 |
ggctttgtgggttttggaaactttgttgttgatttgggaagaggaaaagagattggactaatgggtttgtgtttgtggtggtgatg |
31641876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University