View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5815-Insertion-5 (Length: 100)
Name: NF5815-Insertion-5
Description: NF5815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5815-Insertion-5 |
 | |
|
| [»] chr8 (4 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 84; Significance: 2e-40; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 84; E-Value: 2e-40
Query Start/End: Original strand, 9 - 100
Target Start/End: Complemental strand, 2531343 - 2531252
Alignment:
| Q |
9 |
tgaataagaatatttttgttggtgcaaggaccgctaaaacttagtttcgacaccataaatgtttttcctgctggtatgaccagtgttgacat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
2531343 |
tgaataagaatatttttgttggtgcaaggaccgctaaaacttagtttcgacaccataaatgtttttcctacgggtatgaccagtgttgacat |
2531252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 76; E-Value: 1e-35
Query Start/End: Original strand, 9 - 100
Target Start/End: Complemental strand, 2540679 - 2540588
Alignment:
| Q |
9 |
tgaataagaatatttttgttggtgcaaggaccgctaaaacttagtttcgacaccataaatgtttttcctgctggtatgaccagtgttgacat |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
2540679 |
tgaataagaatatgtttgttggtgcaaggaccgttaaaacttagtttcgacaccataaatgtttttcctactggtataaccagtgttgacat |
2540588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 44; E-Value: 1e-16
Query Start/End: Original strand, 37 - 100
Target Start/End: Complemental strand, 1827912 - 1827849
Alignment:
| Q |
37 |
gaccgctaaaacttagtttcgacaccataaatgtttttcctgctggtatgaccagtgttgacat |
100 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||| ||||| || ||||||||||| |
|
|
| T |
1827912 |
gaccgctaaaaattactttcgacaccataaatgtttttcctgccggtataactagtgttgacat |
1827849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 44; E-Value: 1e-16
Query Start/End: Original strand, 37 - 100
Target Start/End: Complemental strand, 1862357 - 1862294
Alignment:
| Q |
37 |
gaccgctaaaacttagtttcgacaccataaatgtttttcctgctggtatgaccagtgttgacat |
100 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||| ||||| || ||||||||||| |
|
|
| T |
1862357 |
gaccgctaaaaattactttcgacaccataaatgtttttcctgccggtataactagtgttgacat |
1862294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University