View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5815-Insertion-6 (Length: 82)
Name: NF5815-Insertion-6
Description: NF5815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5815-Insertion-6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 68; Significance: 5e-31; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 68; E-Value: 5e-31
Query Start/End: Original strand, 8 - 75
Target Start/End: Complemental strand, 46873151 - 46873084
Alignment:
| Q |
8 |
aatttacacttatctccatagggacatttctccccattgcaatacttcttgcacagtttcatcttgtt |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46873151 |
aatttacacttatctccatagggacatttctccccattgcaatacttcttgcacagtttcatcttgtt |
46873084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000002
Query Start/End: Original strand, 12 - 69
Target Start/End: Complemental strand, 46890469 - 46890412
Alignment:
| Q |
12 |
tacacttatctccatagggacatttctccccattgcaatacttcttgcacagtttcat |
69 |
Q |
| |
|
|||| ||||||||||| ||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
46890469 |
tacagttatctccatatggacattcctccccattgcaataattcttgcacagtttcat |
46890412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University