View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5815_low_1 (Length: 259)
Name: NF5815_low_1
Description: NF5815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5815_low_1 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 259
Target Start/End: Original strand, 7457844 - 7458087
Alignment:
| Q |
18 |
acccttgtctctttatggaaccctaaaagataagctaattttgataattgcttacaagaacaaacaaagactagacttgatttgagtgagagctgatgaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7457844 |
acccttgtctctttatggaaccctaaaagataagctaattttgataattgcttacaagaacaaacaaagactagacttgatttgagtgagagctgatgaa |
7457943 |
T |
|
| Q |
118 |
aaagatgtctctcgttggttagggatagggagtgagaaaatatcacctagtagtaccatgcnnnnnnnnncttccaatttttgtggcaaattaattgatt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
7457944 |
aaagatgtctctcgttggttagggatagggagtgagaaaatatcacctagtagtaccatgc-ttttttttcttccaatttttgtggccaattaattgatt |
7458042 |
T |
|
| Q |
218 |
ccacgttcttaccattaatcaatca---aactcaagacattagct |
259 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7458043 |
ccacgttcttaccattaatcaatcaaataactcaagacattagct |
7458087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 37 - 156
Target Start/End: Original strand, 7442585 - 7442704
Alignment:
| Q |
37 |
accctaaaagataagctaattttgataattgcttacaagaacaaacaaagactagacttgatttgagtgagagctgatgaaaaagatgtctctcgttggt |
136 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| ||| |||||||||||||||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
7442585 |
accctaaaagataagctaattttgatcattgcttacaagaagaaagaaagactagacttgatttgagtgagagcagattaaaaagatgtctctcattggt |
7442684 |
T |
|
| Q |
137 |
tagggatagggagtgagaaa |
156 |
Q |
| |
|
||||| |||||| ||||||| |
|
|
| T |
7442685 |
tagggttagggaatgagaaa |
7442704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University