View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5816_low_4 (Length: 276)
Name: NF5816_low_4
Description: NF5816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5816_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 17 - 266
Target Start/End: Complemental strand, 47128166 - 47127923
Alignment:
| Q |
17 |
catccaagcaaagcacatagaaaatagtttagatgggcttacaatagatgaggtactaatagagatcaaaattcacttattcattgactaaaagttgtat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47128166 |
catccaagcaaagcacatagaaaatagtttagatgggcttacaatagatgaggtactaatagagatcaaaattcacttattcattgactaaaagttgtat |
47128067 |
T |
 |
| Q |
117 |
gaaaatgaagtcaaattcatgttgaatgttataaactctacatatatcgctaacaagaatcaaacttctttatgttgcaggctcttgaaagtgataagct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47128066 |
gaaaatgaagtcaaattcatgttgaatgttataatc------aatatcgctaacaagaatcaaacttctttatgttgcaggctcttgaaagtgataagct |
47127973 |
T |
 |
| Q |
217 |
ctatatattagatcatcatgatgctttgatgccatacctaagtagaataa |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47127972 |
ctatatattagatcatcatgatgctttgatgccatacctaagtagaataa |
47127923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University