View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5817-Insertion-11 (Length: 41)
Name: NF5817-Insertion-11
Description: NF5817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5817-Insertion-11 |
 | |
|
| [»] chr5 (3 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 33; Significance: 0.0000000001; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.0000000001
Query Start/End: Original strand, 9 - 41
Target Start/End: Original strand, 38380870 - 38380902
Alignment:
| Q |
9 |
gttcgttcacaatctcacgtagaaaagatgctg |
41 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38380870 |
gttcgttcacaatctcacgtagaaaagatgctg |
38380902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.0000000001
Query Start/End: Original strand, 9 - 41
Target Start/End: Original strand, 38389736 - 38389768
Alignment:
| Q |
9 |
gttcgttcacaatctcacgtagaaaagatgctg |
41 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38389736 |
gttcgttcacaatctcacgtagaaaagatgctg |
38389768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.0000000001
Query Start/End: Original strand, 9 - 41
Target Start/End: Original strand, 38398499 - 38398531
Alignment:
| Q |
9 |
gttcgttcacaatctcacgtagaaaagatgctg |
41 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38398499 |
gttcgttcacaatctcacgtagaaaagatgctg |
38398531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University