View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5817_high_9 (Length: 260)
Name: NF5817_high_9
Description: NF5817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5817_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 19 - 143
Target Start/End: Complemental strand, 42038133 - 42038009
Alignment:
| Q |
19 |
cttgggtggtttgtcttccaattctcgacagcccattaggtttggtccctctccctgttcccctagggaatgggcaacttccgacgagtagtctggtttt |
118 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42038133 |
cttgggtggtttgtcttccaatcctcgacagcccattaggtttggtccctctccctgttcccctagggaatgggcaacttccgacgggtagtctggtttt |
42038034 |
T |
|
| Q |
119 |
ggaggttattctcaggtttttggga |
143 |
Q |
| |
|
| ||||||||||||||||||||||| |
|
|
| T |
42038033 |
gtaggttattctcaggtttttggga |
42038009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 212 - 260
Target Start/End: Complemental strand, 42037940 - 42037892
Alignment:
| Q |
212 |
ggtacccctggggctcaggctgctattttctgtttgttttgtagcactc |
260 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42037940 |
ggtacccctggggctcaggctgctactttctgtttgttttgtagcactc |
42037892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University