View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5817_high_9 (Length: 260)

Name: NF5817_high_9
Description: NF5817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5817_high_9
NF5817_high_9
[»] chr7 (2 HSPs)
chr7 (19-143)||(42038009-42038133)
chr7 (212-260)||(42037892-42037940)


Alignment Details
Target: chr7 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 19 - 143
Target Start/End: Complemental strand, 42038133 - 42038009
Alignment:
19 cttgggtggtttgtcttccaattctcgacagcccattaggtttggtccctctccctgttcccctagggaatgggcaacttccgacgagtagtctggtttt 118  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
42038133 cttgggtggtttgtcttccaatcctcgacagcccattaggtttggtccctctccctgttcccctagggaatgggcaacttccgacgggtagtctggtttt 42038034  T
119 ggaggttattctcaggtttttggga 143  Q
    | |||||||||||||||||||||||    
42038033 gtaggttattctcaggtttttggga 42038009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 212 - 260
Target Start/End: Complemental strand, 42037940 - 42037892
Alignment:
212 ggtacccctggggctcaggctgctattttctgtttgttttgtagcactc 260  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||    
42037940 ggtacccctggggctcaggctgctactttctgtttgttttgtagcactc 42037892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University