View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5821-Insertion-5 (Length: 240)
Name: NF5821-Insertion-5
Description: NF5821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5821-Insertion-5 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 7 - 240
Target Start/End: Original strand, 104041 - 104274
Alignment:
| Q |
7 |
cagtgagattgttgtggtaaagacccaagctaattaggttcttcaggtttccaagctcttttggtattggacccaccaattcattcttgtacaattctct |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
104041 |
cagtgagattgttgtggtaaagacccaagctaattaggttcttcaggtttccaagctcttttggtattggacccaccaattcattctcgtacaattctct |
104140 |
T |
|
| Q |
107 |
gcaatcaacaatattaatcaatttatgtcaaagttcagtaaatataagataagagcctaactaatttgcttacagaaactgaagatggtgaaggttccct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
104141 |
gcaatcaacaatattaatcaatttatgtcaaagttcagtaaatataagataagagcttaactaatttgcttacagaaactgaagatggtgaaggttccct |
104240 |
T |
|
| Q |
207 |
agttgaggaaccaaatgaccagaaagttttgcat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
104241 |
agttgaggaaccaaatgaccagaaagttttgcat |
104274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University