View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5821-Insertion-6 (Length: 73)
Name: NF5821-Insertion-6
Description: NF5821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5821-Insertion-6 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 65; Significance: 3e-29; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 3e-29
Query Start/End: Original strand, 9 - 73
Target Start/End: Original strand, 35050486 - 35050550
Alignment:
| Q |
9 |
ggtttgatggaaatgttgaattgcaactagttggtaaggcatgtgatgccttttacgaagttgtt |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35050486 |
ggtttgatggaaatgttgaattgcaactagttggtaaggcatgtgatgccttttacgaagttgtt |
35050550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 4e-22; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 4e-22
Query Start/End: Original strand, 17 - 73
Target Start/End: Complemental strand, 20006911 - 20006855
Alignment:
| Q |
17 |
ggaaatgttgaattgcaactagttggtaaggcatgtgatgccttttacgaagttgtt |
73 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20006911 |
ggaaatgttgaattgcaactagttggtaaagcatgtgatgccttttacgaagttgtt |
20006855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 53; Significance: 4e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 4e-22
Query Start/End: Original strand, 17 - 73
Target Start/End: Original strand, 14123455 - 14123511
Alignment:
| Q |
17 |
ggaaatgttgaattgcaactagttggtaaggcatgtgatgccttttacgaagttgtt |
73 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
14123455 |
ggaaatgttgaattgcaactagttggtaaagcatgtgatgccttttacgaagttgtt |
14123511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.000000000005
Query Start/End: Original strand, 16 - 71
Target Start/End: Original strand, 26304846 - 26304901
Alignment:
| Q |
16 |
tggaaatgttgaattgcaactagttggtaaggcatgtgatgccttttacgaagttg |
71 |
Q |
| |
|
|||||||||||| || |||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
26304846 |
tggaaatgttgagttacaacgtgttggtaaagcatgtgatgccttttacgaagttg |
26304901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 28; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 71
Target Start/End: Complemental strand, 8533135 - 8533080
Alignment:
| Q |
16 |
tggaaatgttgaattgcaactagttggtaaggcatgtgatgccttttacgaagttg |
71 |
Q |
| |
|
|||||||||||| || || | |||||||| ||||||||||||||||| ||||||| |
|
|
| T |
8533135 |
tggaaatgttgagttacagcgtgttggtaaagcatgtgatgccttttatgaagttg |
8533080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University