View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5821_low_5 (Length: 364)
Name: NF5821_low_5
Description: NF5821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5821_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 19 - 346
Target Start/End: Original strand, 18677419 - 18677743
Alignment:
| Q |
19 |
aatatcattttcataatcccctcatcttctgcctcttcaatcttcacaccccccatccttcctcttcacaccccctctctcctctttcaatggcttccat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18677419 |
aatatcattttcataatcccctcatcttctgcctcttcaatcttcacaccccccctcattcctcttcacaccccctctctcctctttcaatggcttccat |
18677518 |
T |
 |
| Q |
119 |
tcccgttttctctccattcactcccatgaaacaaaagcataaacctctatctttccaacctctcttacgcacttgctcttccttttcccttcaaagagtc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |
|
|
| T |
18677519 |
tcccgttttctctccattcactcccatgaaacaaaagcataaacctctatctttccaacctctcttacgcactcgctcttccttttcccttcaaagggtc |
18677618 |
T |
 |
| Q |
219 |
tcaaagggttgttcaatatcgagttttgcttgctcaacttcttctaagtttcatggtggaagagttgggtttaaccatagagaagggaaaacttcgtttc |
318 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18677619 |
tcaaagggttgttcaatatcaagttttgcttgctcaa---cttctaagcttcatggtggaagagttgggtttaaccatagagaagggaaaacttcgtttc |
18677715 |
T |
 |
| Q |
319 |
ttaaatttggtgttgatgaaagtgttgt |
346 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
18677716 |
ttaaatttggtgttgatgaaagtgttgt |
18677743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University