View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5822-Insertion-11 (Length: 160)
Name: NF5822-Insertion-11
Description: NF5822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5822-Insertion-11 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 2e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 2e-78
Query Start/End: Original strand, 9 - 160
Target Start/End: Original strand, 40409790 - 40409941
Alignment:
| Q |
9 |
tgtcatgcatcaactttgtggtggaccttgcttagctcattctttaattcaatcatatcttactcttcctactttttattgtcttttctcctgttattaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40409790 |
tgtcatgcatcaactttgtggtggaccttgcttagctcattctttaattcaatcatatcttactcttcctactttttattgtcttttctcctgttaataa |
40409889 |
T |
 |
| Q |
109 |
cgattaatcatcagttcagttgccaattgccaaaaaattatcttaatacgtg |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40409890 |
cgattaatcatcagttcagttgccaattgccaaaaaattatcttaatacgtg |
40409941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 28; Significance: 0.0000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 9 - 60
Target Start/End: Complemental strand, 4709931 - 4709880
Alignment:
| Q |
9 |
tgtcatgcatcaactttgtggtggaccttgcttagctcattctttaattcaa |
60 |
Q |
| |
|
||||||||||||||||| ||| | ||||||||||||||| ||||| ||||| |
|
|
| T |
4709931 |
tgtcatgcatcaactttatggaaggccttgcttagctcatgctttagttcaa |
4709880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University