View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5822-Insertion-12 (Length: 70)
Name: NF5822-Insertion-12
Description: NF5822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5822-Insertion-12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 61; Significance: 6e-27; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 61; E-Value: 6e-27
Query Start/End: Original strand, 9 - 69
Target Start/End: Original strand, 35050487 - 35050547
Alignment:
| Q |
9 |
gtttgatggaaatgttgaattgcaactagttggtaaggcatgtgatgccttttacgaagtt |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35050487 |
gtttgatggaaatgttgaattgcaactagttggtaaggcatgtgatgccttttacgaagtt |
35050547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 2e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 20006911 - 20006858
Alignment:
| Q |
16 |
ggaaatgttgaattgcaactagttggtaaggcatgtgatgccttttacgaagtt |
69 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20006911 |
ggaaatgttgaattgcaactagttggtaaagcatgtgatgccttttacgaagtt |
20006858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 2e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 16 - 69
Target Start/End: Original strand, 14123455 - 14123508
Alignment:
| Q |
16 |
ggaaatgttgaattgcaactagttggtaaggcatgtgatgccttttacgaagtt |
69 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14123455 |
ggaaatgttgaattgcaactagttggtaaagcatgtgatgccttttacgaagtt |
14123508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 15 - 69
Target Start/End: Original strand, 26304846 - 26304900
Alignment:
| Q |
15 |
tggaaatgttgaattgcaactagttggtaaggcatgtgatgccttttacgaagtt |
69 |
Q |
| |
|
|||||||||||| || |||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
26304846 |
tggaaatgttgagttacaacgtgttggtaaagcatgtgatgccttttacgaagtt |
26304900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University