View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5822_high_26 (Length: 207)
Name: NF5822_high_26
Description: NF5822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5822_high_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 9 - 187
Target Start/End: Complemental strand, 54836810 - 54836632
Alignment:
| Q |
9 |
agtgagatgaagatgaagatagagtgaattagtatcactacttactgagatcgtttttgtgaataatgtcaaaattattttttctgaaatatttacggat |
108 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54836810 |
agtgaaatgaagatgaagaaagagtgaattagtatcactacttactgagatcgtttttgtgaataatgtcaaaattattttttctgaaatatttacggat |
54836711 |
T |
 |
| Q |
109 |
gacatctccggcggcgtcggcggctttgttagcgacgtcggagaagtgattgagttggtgaggaggcgaagatgaggag |
187 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54836710 |
gacatctccagcggcgttggcggctttgttagcgacgtcggagaagtgattgagttggtgaggaggcgaagatgaggag |
54836632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University