View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5822_high_5 (Length: 497)
Name: NF5822_high_5
Description: NF5822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5822_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 1e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 1e-94
Query Start/End: Original strand, 11 - 319
Target Start/End: Complemental strand, 31646671 - 31646363
Alignment:
| Q |
11 |
cataggctaaaataccttttatcataaactatatattatttggttctaagttaattcccgattaactttgaagtttcatttcatccaatttgtataaaaa |
110 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
31646671 |
cataggctaaaataccttttgtcataaactatatattatttggttctaagttaattcccgattaactttaaagtttcatttcatccagtttgtataaaaa |
31646572 |
T |
|
| Q |
111 |
tattaatccaaattatatagaaggtttttatactaattcatcaccaactcaccaatcctgttcaaaatgaaggttttcattatgaccaaccttatcacaa |
210 |
Q |
| |
|
||||||||||||||| |||||||| |||||| ||||||||||||||||||| |||| |||||||| ||||||||||||| ||| |||||||||||||||| |
|
|
| T |
31646571 |
tattaatccaaattacatagaagggttttatcctaattcatcaccaactcatcaatactgttcaagatgaaggttttcactatcaccaaccttatcacaa |
31646472 |
T |
|
| Q |
211 |
ctccnnnnnnnnnnnnnnnnnnnnattgaaacaactcttatgtgtaatgttttgtatacacagcttaa--tctatagtaaagagacaacattcaatgttt |
308 |
Q |
| |
|
||| | |||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |||||||||||| |
|
|
| T |
31646471 |
ctc--ttttttttttttttttttgaatgaaacaactcttatgtgtaatgttttgtatacacagcttaatttctaaagtaaagagacagcattcaatgttt |
31646374 |
T |
|
| Q |
309 |
attactcgaaa |
319 |
Q |
| |
|
||||||||||| |
|
|
| T |
31646373 |
attactcgaaa |
31646363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 105; Significance: 3e-52; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 322 - 481
Target Start/End: Original strand, 34811102 - 34811259
Alignment:
| Q |
322 |
taagtatgtgtttgcttccgcgtttgaccccttctctctctccacatttagagcacttttttgttgtggttttgagaaactataaattgtagcttatgtg |
421 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||| |||| |||||||| ||| ||||||| ||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
34811102 |
taagtatgtgtttgcttcagtgtttgaccccttctttctc--cacatttaaagcgcttttttattgtggttttgagaagctacaaattgtagcttatgtg |
34811199 |
T |
|
| Q |
422 |
caaacgtgactttatgccttgcttttgccaagacgtgaaaattgtaccgctccaccaaac |
481 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| ||||||||| ||||| |
|
|
| T |
34811200 |
caaacgtgactttatgccttgcttttgccaagacgtggaaattgcaccgctccatcaaac |
34811259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 415 - 481
Target Start/End: Complemental strand, 3608400 - 3608334
Alignment:
| Q |
415 |
ttatgtgcaaacgtgactttatgccttgcttttgccaagacgtgaaaattgtaccgctccaccaaac |
481 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
3608400 |
ttatgtgcaaatatgactttatgccttgcttttgccaagatgtggaaattgtaccgctccaccaaac |
3608334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 325 - 381
Target Start/End: Complemental strand, 3608453 - 3608399
Alignment:
| Q |
325 |
gtatgtgtttgcttccgcgtttgaccccttctctctctccacatttagagcactttt |
381 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
3608453 |
gtatgtgtttacttcagcgtttgaccccttctc--tctccacgtttagagcactttt |
3608399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University