View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5822_low_15 (Length: 315)
Name: NF5822_low_15
Description: NF5822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5822_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 17 - 299
Target Start/End: Original strand, 7948901 - 7949186
Alignment:
| Q |
17 |
tggtgatggggtgaggcgacttggctctcaagtttgtttaaaannnnnnnnnnn--aatttattttgctagtgaattgaatttgttttgtttgttaaaaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7948901 |
tggtgatggggtgaggcgacttggctctcaagtttgtttaaaatttttttttttttaatttattttgctagtgaattgaatttgttttgtttgttaaaaa |
7949000 |
T |
 |
| Q |
115 |
acacttataccattttgagattatgttgatttaattaaacttattctattttgaggttattgttgaggaactaatttattttcaaaatattatatgtaag |
214 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7949001 |
atacttataccattttgagattatgttgatttaattaaacttattctattttgaggttattgttgaacaactaatttattttcaaaatattatatgtaag |
7949100 |
T |
 |
| Q |
215 |
tatagatt-ggggcattaacgaaatcatatttagttcacacatttaatttagtggaaaaagtttaaccttataatctcgatgtatt |
299 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
7949101 |
tatagattaggggcattaacaaaatcatatttagttcacacatttaatttagtggaaaaagtttaaccttataatcttgatatatt |
7949186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University