View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5822_low_21 (Length: 251)
Name: NF5822_low_21
Description: NF5822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5822_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 13911228 - 13910985
Alignment:
| Q |
1 |
cagttagcatatatatcaaactcataagattagatttcataccttcctaagccaatataatgttaacatctatcatatagtggttgctaggaatgaatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13911228 |
cagttagcatatatatcaaactcataagattagatttcataccttcctaagccaatataatgttaacatctatcatatagtggttgctaggaatgaatga |
13911129 |
T |
|
| Q |
101 |
taatgtatacaaatgtcacatccttcaaatggnnnnnnngaatatttagtcttattgaatatattgtgatgccctttttcggtcccaatttctcttttat |
200 |
Q |
| |
|
||| ||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13911128 |
taacgtatataaatgtcacatccttcaaatgg-ttttttgaatatttagtcttattgaatatattgtgatgccctttttcggtcccaatttctcttttat |
13911030 |
T |
|
| Q |
201 |
gtatcgataaattccaacaactaacatctttatgctctctgctcc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
13911029 |
gtatcgataaattccaacaactaacatctttatgctttctgctcc |
13910985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University