View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5822_low_22 (Length: 248)

Name: NF5822_low_22
Description: NF5822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5822_low_22
NF5822_low_22
[»] chr5 (2 HSPs)
chr5 (133-248)||(31646850-31646966)
chr5 (6-58)||(31647042-31647094)


Alignment Details
Target: chr5 (Bit Score: 77; Significance: 8e-36; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 133 - 248
Target Start/End: Complemental strand, 31646966 - 31646850
Alignment:
133 gagacgattaattccataaataaattatacatcagtctatgcaannnnnnngtcaaaatttcatcatgtgtcaaccatat--tgagagagattaacttct 230  Q
    ||||||||||||||||||||||||||||||||||||||||||||       ||||||| |||||||||||||||||||||  ||||||||||||||||||    
31646966 gagacgattaattccataaataaattatacatcagtctatgcaatttttt-gtcaaaaattcatcatgtgtcaaccatatgttgagagagattaacttct 31646868  T
231 taatcaaattacaattac 248  Q
    ||||||||||||||||||    
31646867 taatcaaattacaattac 31646850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 6 - 58
Target Start/End: Complemental strand, 31647094 - 31647042
Alignment:
6 aaattattctgaattataagtcattttaaaacaattattgtcggattttatgt 58  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||    
31647094 aaattattctgaattataagtcattttaaaacaattattgtcggtttttatgt 31647042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University