View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5822_low_22 (Length: 248)
Name: NF5822_low_22
Description: NF5822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5822_low_22 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 77; Significance: 8e-36; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 133 - 248
Target Start/End: Complemental strand, 31646966 - 31646850
Alignment:
| Q |
133 |
gagacgattaattccataaataaattatacatcagtctatgcaannnnnnngtcaaaatttcatcatgtgtcaaccatat--tgagagagattaacttct |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31646966 |
gagacgattaattccataaataaattatacatcagtctatgcaatttttt-gtcaaaaattcatcatgtgtcaaccatatgttgagagagattaacttct |
31646868 |
T |
|
| Q |
231 |
taatcaaattacaattac |
248 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
31646867 |
taatcaaattacaattac |
31646850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 6 - 58
Target Start/End: Complemental strand, 31647094 - 31647042
Alignment:
| Q |
6 |
aaattattctgaattataagtcattttaaaacaattattgtcggattttatgt |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31647094 |
aaattattctgaattataagtcattttaaaacaattattgtcggtttttatgt |
31647042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University