View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5822_low_29 (Length: 207)

Name: NF5822_low_29
Description: NF5822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5822_low_29
NF5822_low_29
[»] chr3 (1 HSPs)
chr3 (9-187)||(54836632-54836810)


Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 9 - 187
Target Start/End: Complemental strand, 54836810 - 54836632
Alignment:
9 agtgagatgaagatgaagatagagtgaattagtatcactacttactgagatcgtttttgtgaataatgtcaaaattattttttctgaaatatttacggat 108  Q
    ||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54836810 agtgaaatgaagatgaagaaagagtgaattagtatcactacttactgagatcgtttttgtgaataatgtcaaaattattttttctgaaatatttacggat 54836711  T
109 gacatctccggcggcgtcggcggctttgttagcgacgtcggagaagtgattgagttggtgaggaggcgaagatgaggag 187  Q
    ||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54836710 gacatctccagcggcgttggcggctttgttagcgacgtcggagaagtgattgagttggtgaggaggcgaagatgaggag 54836632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University