View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5823-Insertion-8 (Length: 56)
Name: NF5823-Insertion-8
Description: NF5823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5823-Insertion-8 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
| [»] chr6 (3 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 44; Significance: 6e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 6e-17
Query Start/End: Original strand, 9 - 56
Target Start/End: Original strand, 34577927 - 34577974
Alignment:
| Q |
9 |
tcatgtaccttagctaatgcccaaatgctaaaatgggcacgatattcc |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34577927 |
tcatgtaccttagctaatgcccaaatgctgaaatgggcacgatattcc |
34577974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.0000000009; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.0000000009
Query Start/End: Original strand, 9 - 56
Target Start/End: Original strand, 32590167 - 32590214
Alignment:
| Q |
9 |
tcatgtaccttagctaatgcccaaatgctaaaatgggcacgatattcc |
56 |
Q |
| |
|
||||| ||||||||||||||||| ||||| ||||||| |||||||||| |
|
|
| T |
32590167 |
tcatgcaccttagctaatgcccagatgctgaaatgggaacgatattcc |
32590214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.0000000009
Query Start/End: Original strand, 9 - 56
Target Start/End: Original strand, 32600615 - 32600662
Alignment:
| Q |
9 |
tcatgtaccttagctaatgcccaaatgctaaaatgggcacgatattcc |
56 |
Q |
| |
|
||||| ||||||||||||||||| ||||| ||||||| |||||||||| |
|
|
| T |
32600615 |
tcatgcaccttagctaatgcccagatgctgaaatgggaacgatattcc |
32600662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.00000006
Query Start/End: Original strand, 15 - 55
Target Start/End: Complemental strand, 24883773 - 24883733
Alignment:
| Q |
15 |
accttagctaatgcccaaatgctaaaatgggcacgatattc |
55 |
Q |
| |
|
|||||| |||||||||| ||||| ||||||||||||||||| |
|
|
| T |
24883773 |
accttaactaatgcccatatgctgaaatgggcacgatattc |
24883733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University