View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5823_high_13 (Length: 250)
Name: NF5823_high_13
Description: NF5823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5823_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 99; Significance: 6e-49; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 46 - 148
Target Start/End: Complemental strand, 2815728 - 2815626
Alignment:
| Q |
46 |
aattaaaaattttacaaccacaatgaactttgatgctgtggtgtttggaagaacttatttggacctatcttgaaatagtttatgaaaatataataccgca |
145 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2815728 |
aattaaaaattctacaaccacaatgaactttgatgctgtggtgtttggaagaacttatttggacctatcttgaaatagtttatgaaaatataataccgca |
2815629 |
T |
 |
| Q |
146 |
tga |
148 |
Q |
| |
|
||| |
|
|
| T |
2815628 |
tga |
2815626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 146 - 233
Target Start/End: Complemental strand, 2815237 - 2815157
Alignment:
| Q |
146 |
tgaattcaatctcagtatctttatatatctgattgattttgtttgtagccgatgtcatatattaattctcatatttttctatcccttt |
233 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2815237 |
tgaattcaatctcaatatctttatatatctgattgattttgtttgtagccgatgtc-------aattctcatatttttctatcccttt |
2815157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 64 - 115
Target Start/End: Complemental strand, 5428455 - 5428404
Alignment:
| Q |
64 |
cacaatgaactttgatgctgtggtgtttggaagaacttatttggacctatct |
115 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||| ||||| |
|
|
| T |
5428455 |
cacaatgaactttgatgcttaggtgtttataagaacttatttggacttatct |
5428404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University