View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5823_low_12 (Length: 251)
Name: NF5823_low_12
Description: NF5823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5823_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 22293403 - 22293185
Alignment:
| Q |
1 |
attgaaaaactaatgaaaacgggataaggaatataccaattaatatatactatgtgtgtgcatgcttggttgaacttgaacctttgaatagaaactttgt |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22293403 |
attggaaaactaatgaaaacgggataaggaatataccaattaatatatactatgtgtgtgcatgcttggttgaacttgaacctttgaatagaaactttgt |
22293304 |
T |
|
| Q |
101 |
gcttttacctcattggtttacgtaacattctttaattaagatatactagtttatgtcttgtgattagggataaacaaatctcaaaagcatattaacaaaa |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22293303 |
gcttttacttcattggtttacgtaacattctttaatta--------------atgtcttgtgattagggataaacaaatctcaaaagcatattaacaaaa |
22293218 |
T |
|
| Q |
201 |
agaaacactagggagcctagaaagacattaatg |
233 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
22293217 |
agaaacactagggagcctagaatgacattaatg |
22293185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University